Search to prove an extraterrestrial origin:

First part: Datation files

Second part: DNA Analysis

Third part: Conclusion

Copper-ring-from-possible-crash

 

Carbon 14 analysis of the fossils probably Alien:

Datation files, here...

Part of the interview about my sample (Datation); Sensitive Fossil (in french):

Discussion

2014-03-29 1:15 GMT+01:00 Didier Jegaden Amidijepass@aol.com:

Bonjour Dr. Jonathan Brochard, Effectivement, je peux préciser ce que j'ai fait dater... En fait, l'échantillon (Sensitive Fossil) est un morceau de l'arrière du buste de la créature qui est probablement d'origine extraterrestre; voici le lien youtube ci-dessous; ou vous pourrez voir l'origine de l'échantillon:

Possible Extraterrestrial Alien Fossil - YouTube

Bien cordialement,

Didier Jégaden

Le 28 mars 2014 à 10:49, Jonathan Brochard a écrit :

Bonjour et merci pour votre réponse.

J'apprécie de pouvoir en savoir plus sur vos recherches et sur votre expérience avec Beta Analytic. J'ai en effet regardé quelques vidéos sur YouTube avant de vous appeler mais je ne savais pas que l'échantillon était en fait lié avec vos découvertes. Je suis curieux de savoir ce que vous avez pu dater de ce fossile qui avait du contenu organique. Merci d'avance et n'hésitez pas si vous avez des questions à l'avenir par rapport à nos services.

Cordialement,

Jonathan ---

Jonathan Brochard

Research Associate

Web Sites: www.radiocarbon.com BETA is an Accredited ISO/IEC 17025:2005 testing laboratory operating in conformance with ISO 9001:2008 management system requirements. It has demonstrated both the technical competency and management system requirements necessary to consistently deliver technically valid test results. These standards are universally recognized as the highest level of quality attainable by a testing laboratory.

2014-03-27 20:42 GMT+01:00 Didier Jegaden Amidijepass@aol.com: Bonjour Dr. Jonathan Brochard,

Je n'ai pas particulièrement de question sur le fonctionnement de l'analyse Radiocarbone du C14 de mon échantillon(Sensitive fossile); c'était très clair et bien expliqué. Cette analyse du C-14 contenu dans mon échantillon donne l'âge de 38400 ans (avec une marge d'erreur de 440 ans)!! Ce fossile est d'après mon expérience, probablement une créature fossilisée d'origine extraterrestre... Cela est évidement très difficile a croire! Si vous regardez mes websites vous comprendrez mieux, je ne cherche pas a convaincre, j'expose juste mes découvertes de Paléontologie faites en Oklahoma... Je peux vous donner le lien direct: Recherches sur la vie extraterrestre et Recherche sur les anciens et les extraterrestres A vrai dire, je suis très content de vos services, c'était juste l'analyse au radiocarbone du C14 qui était la mieux adaptée et probablement la plus précise.

Le rapport qualité/prix de l'analyse m'a agréablement surpris! Pour une note d'evaluation a donner sur l'entreprise Beta Analytic: 10/10 pour l'analyse de mon échantillon. Je reste a votre disposition pour plus de renseignement... Bien cordialement,

Le 27 mars 2014 à 11:24, Jonathan Brochard a écrit :

Bonjour Mr. Jegaden, Je cherchais à vous joindre aujourd'hui pour discuter de votre expérience avec l'envoi d'échantillon, les résultats et pour savoir si vous aviez la moindre question. On peut convenir d'un moment qui vous convient pour un rapide appel ou si c'est plus simple, n'hésitez pas à me donner votre avis par courriel. Merci d'avance.

Cordialement,

Jonathan Brochard

Research Associate

Web Sites: www.radiocarbon.com

BETA is an Accredited ISO/IEC 17025:2005 testing laboratory operating in conformance with ISO 9001:2008 management system requirements. It has demonstrated both the technical competency and management system requirements necessary to consistently deliver technically valid test results. These standards are universally recognized as the highest level of quality attainable by a testing laboratory.

 

Koundalini and ring:

OVNI

Weather and ring

OVNI 1

Wild minnows (fish tiger) show an attraction to my hands ...
Minnows are often used as tester for scientific experiments. I think here, they attracted my hands because there is a surplus of energy at this level; yesterday, it was my back (spine) ... July 2015:

DNA and Analyses

OVNI2

 

Part of tooth found in the Miniature Sepulture

BONE

 

Possible Alien Skull Fossil(1) -French version- 2015

Possible Alien Skull Fossil(1) -English version-2016

Part of the search on DNA:

Universal identification through DNA on the hairs

A DNA sequence was produced for the universal 16S mitochondrial region.
CAGTACATGCTAAGACTTCACCAGTCAAAGCGAACTACTATACTCAATTGAT
CCAATAACTTGACCAACGGAACAAGTTACCCTAGGGATAACAGCGCAATCC
TATTCTAGAGTCCATATCAACAATAGGGTTTACGACCTCGATGTTGGATCAG
GACATCCCGATGGTGCAGCCGCTATTAAAGGTTCGTTTGTTCAACGATTAAA
GTCCTACGT
The closest match of readable 16S sequence, using a genetic database
(National Center for Biotechnology Information (NCBI) BLAST, Basic Local
Alignment Search Tool, nucleotide database) was identified as a 100% match to
Homo sapiens (human).

 

View on the short hairs with a magnifying glass, possible alien skull fossil(1):

Skull-hairs-from-the-video


Hair sample for DNA analysis (Universal identification through DNA on hair)

DNA-on-hair

Stephen Fratpietro
Technical Manager, Paleo-DNA Laboratory
Lakehead University
1294 Balmoral St. Suite 300
Thunder Bay, ON, CAN, P7B 5Z5
t: (807) 343-8892

w. www.ancientdna.com 


Lakehead is proud to be ranked RESEARCH Info$ource's Research University of the Year. To learn more about Lakehead University's exceptional 50-year journey and our accomplishments of the past year, see our 2014/2015 Annual Report.

Context:


I think the results of the Universal Identification though DNA on hair, 100% Homo-Sapiens are right because the Laboratory found the same result two times, with the two hair samples; in August 2015 (8/5/15)-the copper keepsake locket at the top of the page- and in February 2016 (02/19/16)- possible alien skull fossil(1)- from the same archeologic site. I don't think there is any contamination from me or something else in these cases.

I want to thanks the Paleo-DNA Laboratory, for the work they did this year(2016) and the last year, on my artifacts!

I work in a humane society, with dogs and when I see the morphology of a dog compared to another dog; like a German shepherd with a bulldog; it doesn't look like the same animal but it is still two dogs.

Subject to different climatic and dietary constraints, the animals do not evolve in the same way. But besides the time factor, the new races can be born of unexpected crossings. For example, we know that the wolf, coyote and dogs can "hybridize" and produce fertile offspring: they are in fact one and the same species by definition. However, the descendants could make a new race...

The arrival of genetics has confirmed this hypothesis: the dog and the gray wolf from Europe, shares the mitochondrial DNA.

-Species and race, look at Darwin theory-

When we look at the seven fossil skulls, they all look different! It's probably, also, a morphology problem:

They share with us(Humans), the mitochondrial DNA but, in my opinion, they didn't came from the same planet:

Subject to different climatic, dietary constraints and a different solar system...

(Definition: Morphology, biology field that treats the external structure of animals and plants, and describes their varieties...)

Two years ago, I did a Radiocarbon Datation analysis(BETA ANALYTIC) of one of the "human extraterrestrial fossils" and we found the age to be approximately 38,100 years old!...

Didier Jégaden

Amidijepass@aol.com (e-mail)

 

Artifact(combinaison-zip) from the possible crash: the encounter

Artifact-from-the-possible-crash

 

Asgarde/www.GrainetCristal.fr

Copyrights 2014/15/16